Review



primer sequences unigene id gene annotation forward primer  (Unigene)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Unigene primer sequences unigene id gene annotation forward primer
    Primer Sequences Unigene Id Gene Annotation Forward Primer, supplied by Unigene, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+sequences+unigene+id+gene+annotation+forward+primer/amplification+annotation+atccctgctcatcggttgtg+efficiency+forward+id+lipophorin+pc76893+receptor+reverse+tgtgacacggagaacgactg/10__1016_slash_j__jff__2025__107037-82-2-4
    Average 86 stars, based on 1 article reviews
    primer sequences unigene id gene annotation forward primer - by Bioz Stars, 2026-10
    86/100 stars

    Images

    Related Articles

    other:

    Article Title: Total alkaloids of Zanthoxylum schinifolium Siebold & Zucc attenuate ulcerative colitis by re-profiling gut microenvironment and inhibiting TLR4/NF-κB pathway
    Article Snippet: Table 2 Primer sequences Unigene ID Gene annotation Forward primer (5′ → 3′) Reverse primer(5′ → 3′) 11,461 Actb ACTGTCGAGTCGCGTCCA ATCCATGGCGAACTGGTGG 21,926 Tnf GCCCTGGATACCAACTATTGCTTCA CAGAAGTTGGCATGGT 16,176 Il1b ATGCCCAACCCTAGGCCAGCCAAGC GGATAAGGGTGGCATAGGTGAAA 16,193 Il6 GCAGCAACAGGAACAAGTGG GCTTTGCCTCGTTCTGGACT M/Z:mass-to charge ratio; RT: retention time.



    Similar Products

    primer sequences unigene id gene annotation forward primer  (Unigene)
    86
    Unigene primer sequences unigene id gene annotation forward primer
    Primer Sequences Unigene Id Gene Annotation Forward Primer, supplied by Unigene, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+sequences+unigene+id+gene+annotation+forward+primer/amplification+annotation+atccctgctcatcggttgtg+efficiency+forward+id+lipophorin+pc76893+receptor+reverse+tgtgacacggagaacgactg/10__1016_slash_j__jff__2025__107037-82-2-4
    Average 86 stars, based on 1 article reviews
    primer sequences unigene id gene annotation forward primer - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier

    Image Search Results